EST details — SGN-E454259

Search information 
Request: 454259Match: SGN-E454259
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C241786Clone name: cSTS-22-N23
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E454259Length: 771 bp (921 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E454259 [] (trimmed) CTTCTTCGACATCATCTGGCCCAGAAATCCCTTGGGTTGAGAAGTTCCGACCCACCAAAGTATCCGACATCGTCGGCAATGAAGATGCTGTTTCC
AGGCTTCAAGTTATTGCTCGTGATGGAAACATGCCCAATCTTATTTTAGCCGGTCCTCCGGGTACTGGCAAAACCACTAGTATATTGGCTCTTGC
TCATGAGCTTTTGGGACCAAACTATAAGGAGGCTGTGTTGGAGCTAAATGCATCAGATGATAGAGGCATCGATGTTGTTAGAAACAAAATCAAGA
TGTTTGCTCAGAAGAAAGTTACTCTACCCCCTGGTCGGCACAAAATAATTATTTTGGATGAGGCTGACAGCATGACATCTGGAGCTCAGCAAGCA
CTGAGGAGGACAATGGAAATATATTCGAACTCCACTCGCTTTGCTCTTGCCTGCAATACTTCTTCTAAGATTATCGAACCTATTCAAAGTAGATG
TGCCCTGGTCCGATTTGCAAGATTATCTGACCAAGAGATCCTTGGACGCCTTATGGCTGTAGTTGCAGCAGAAAAGGTTGCTTATGTACCTGAAG
GTCTTGAAGCTATTATATTTACTGCTGATGGAGATATGAGACAAGGCTTAAATAACTTACAAGCAACACACAGTGGATTTGGNTTTTGTCAACCA
AGAAGATGTTTTCAAGGTTTGTGACCAACCTCATCCTTTGCATGTGAAGAATATGGTGNCGGAATGTCCTCGAAGGGAAATTTGATGATGCATGT
GGCTGGTCTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E454259] SGN-U272097 Solanum tuberosum Build 4 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T239835 [Download] [View] Facility Assigned ID: PEYDI84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.993 Expected Error Rate: 0.0122 Quality Trim Threshold: 14.5