EST details — SGN-E454750

Search information 
Request: 454750Match: SGN-E454750
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C242179Clone name: cSTS-24-C10
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E454750Length: 698 bp (900 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E454750 [] (trimmed) GACGATCGGAGATGGCGCGAAGAATATCGATCCACTGGTTCGCGCTCACACTTACTATCGTGCTCTCCCTTCTCGTTCAGCCTTGTTTCTCCATA
TACTGTGACGAAGATGACTGTTACGATCTCCTTGGGGTTACTCAAAATGCCAATTCTTCTGAAATCAAGAAAGCTTATTACAAGCTCTCTCTAAA
ACATCATCCAGATAAAAACCCTGATCCAGAATCAAAGAAGCTTTTTGTGAAAATTGCAAATGCGTATGAGATTTTGAAAAACGAAGCCACAAGGG
AGCAGTATGATTATGCACTTGCCCATCCAGAGGAGTTTTTCTACAATACAGCACGGTATTACCATGCTTACTATGGTCACAAAACTGATACCCGT
GCTGTGCTCGTTGGTCTTCTTTTGATAGTCTCAATATTTCAGTATCTGAATCAGTGGACAAGATATAATCAGGCTATTGACATGGTCAAGAAAAC
ACCAGCTTATAAAAACAAGCTACGTGCTTTGGAGCTTCAACGCACTGGAGGAATGGCTAATAGGAAGAAGGGCAACAAGCCGATGGACAAGAAGG
TGGAAGAAGAACTTGGCAAGGAACTCAACTTGGACATAAAGGGCACTGAAAAGCCTGCTGTTTGGGATCTAATTGGAATTCGTTTTATACTTCTT
CCTTACACTCTGGGAAAGCTGTTATTGTGGTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E454750] SGN-U272089 Solanum tuberosum Build 4 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T240326 [Download] [View] Facility Assigned ID: PEYDP17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5