EST details — SGN-E454892

Search information 
Request: 454892Match: SGN-E454892
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C242427Clone name: cSTS-24-N23
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E454892Length: 754 bp (893 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E454892 [] (trimmed) GTGAAGGACTGCTGTAACTAGGATCTTGCTTTTGCATTTTTGTCAGCCAGATCAGTGAAAACATAATGAAGCTTCAGCCTTTACTGGCAGCTATT
GCTTTTCTTATTCTGCTGCTATCAGTATTTCTTCATGTTATAGCTGATCTTGATTCCGATAGACAGGCGCTACTCGACTTTGCAGAATCTGTCCC
TCATATCCGAAAACTCAACTGGAATTTGGCTCTCCCTATTTGCAAATCTTGGGCTGGTATAGCTTGTAACAAAGATGGAACGAGAGTCATTGCAA
TCCATCTCCCTGCTGTAGGACTTTTTGGTCCTATCCCAGCTAATAGTATAGGCAAGCTAGATGCTCTTAAAGTACTTAGTCTAAGAGCCAATTAT
CTTAATGGAAGTGTTCCTTCTGATCTCCTTTCGATACCGTCTCTCCAATCTGTCTACCTTCAGCATAATAGCTTCTCTGGTGATATTCCTGTTTC
TTTATCTCCTCGTCTTGGTGTACTAGATCTCTCCTTTAACTCTTTTACTGGAGAAATTCCCCCCACAATCAAGAACTTGACGCGATTATCTGTGC
TGAACCTTCAGTTCAATTCATTGACAGGAGAAATCCCCAGCCTTGACACCCTCANGTTAACTAACCTGAATTTGAGTTACAATATGCTAAATGGC
TCCGTTCCAGACCCCCTNCAGAAGTTTCCACTCACATCATTCGCAGGAAACTCTCATTTATGTGGTACACCTCTAAATAGCTGTTCCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E454892] SGN-U275777 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T240468 [Download] [View] Facility Assigned ID: PEYDQ84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5