EST details — SGN-E455152

Search information 
Request: 455152Match: SGN-E455152
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C242490Clone name: cSTS-25-B11
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E455152Length: 677 bp (877 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E455152 [] (trimmed) GTTCAATTCATCAACAATTGCCAAGTTCATGGTTCCATGTCATGTCGAAAAGGATTCTTTGCAAGTTCTTTGTAAATGGTGCATGTCTGAAAGGA
GAGTACTGTGAGTTCTCGCATGATTGGAAAGATCCTCCAAATAATGTATGCACATACTACCAAAAAGGATTATGTGCCTATGGCAGCAGGTGTAG
ATACAAACATGTTAAAGTTTCTGAACAACCCTCACTTCCATCTTCGTCAGCTCCAGCTCAACATCTGCTCTCAGCTTCTCCTCCCACCACCCTCT
CTCCTGGAATGCTAGCAAATGGTGCAGGACTTCTTTCAGGCATTTCTTCCGCGTCAGGCAGATCTTTTTACCCTCCCAACCAGCCTGTATGGAGT
GAAAATTCAGAGCATCATGATGCGGCAGTTATTGATAATATTGTCGAGTTAAAGAGAATGAATCCAGCTGATCGATCAATTTGCTCTTTTGCTGC
TGCTGGTAAATGTCCACGGNGAGAAAACTGTCCTTATATTCATGGAGATTTATGTCCAATATGTGCGAAGAATTGCTTGCATCCCTTTCGGCCTC
TTGAAAGAGAGGAGCATATAANAATATGTGAGAAGAGGCAAAAGCGCCTTGAGTTACTGAAGCATAGTCAAGAAATAGAGTGCAGTGTATGTCTT
GAACGTGTACTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E455152] SGN-U269993 Solanum tuberosum Build 4 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T240728 [Download] [View] Facility Assigned ID: PEYDU06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.981 Expected Error Rate: 0.0095 Quality Trim Threshold: 14.5