EST details — SGN-E455288

Search information 
Request: 455288Match: SGN-E455288
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C242670Clone name: cSTS-25-J18
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E455288Length: 679 bp (863 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E455288 [] (trimmed) GAAAGGTTTGAGTAAGGCGTATTTGTCGGAGCTCGATTCGGTTTTGGCAAGCCCTAGGCTTAGGAGGTTTTTCTGTAGCGAAGGGCCAAAGAGAA
GAAACTATGAGAATTATTATCCAAAGAACAAGAAAGAAATTCCCAAAGCAAATAATAATCAAAAGGCCGAGTCGGGCAAAGAGGAAGGTTCAGGT
GAGCAAGGAAATCCTCAGGAGAACTTCATTAAGCTAAACTACAATATACTAGCACCCTTATTATTTATTGGGTTTATTCTGTCATCTATCCTCAT
GTCTCCTCGAGAGCAGCAGGAGATTAGCTTCCAAGAGTTCAAAAACAAGCTACTTGAAGCTGGTCTTGTTGATAGGATTGTTGTGACTAACAAAT
CTGTAGCCAAAGTTTATGTGAGAAGCTCTGCACCTGGTCCTGATCAAATTGGTGACGACGCTGTTCAAGGTCCTGTAGCTGGTAGAAATGATAGA
AGAATTACGAGCCAGTACAAATATTACTTTAACATTGGGAGTGTCGAGTCATTCGAGGAGAAGCTTGAAGAAGCACAGGAGGCATTAAGAATAGA
TCCTCATAATTATGTTCCTGTTACATATGTTGATGAACTGAATTGGTTCCAAGAAGTGATGAGGTTTGGTCCAACAGTGTTGCTTCTTGCTGTCC
TTTATTTTATGGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E455288] SGN-U283384 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T240864 [Download] [View] Facility Assigned ID: PEYDV57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0037 Quality Trim Threshold: 14.5