Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-E455708

Search information 
Request: 455708Match: SGN-E455708
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C243254Clone name: cSTS-27-G17
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E455708Length: 677 bp (903 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E455708 [] (trimmed) TTCACTTCATGCGGTCTCTAGAGACCCCGAGGCTTATCGGGATCCTTGTTTATATGCTCAGATTGACAATGGAGTGGAGGATGACGAATCAGAAG
GTTCCAGTGATGAAGGTGATGTGTCATCAGATTTATCAAGGATCACTGAGTTGAGACTTGTGCCATCAGATCCTAATCAAGTGGATACTCTCTTC
CAGATCTTTTGTGATTGTGCTGAGCTTAATCCTGAACCAATTGAAGAGGAGGAGGAACATAATTGGATTTTCAGCGCAGATCAGCTGGAAAATCA
GGAAGCTGAAGAAGATTCTGAATGGATGATTTCTCCAAACTCTACACATCCAATTGGTCGTTCAAATGGGGATCACGACTTAGCTCATAATGTAC
TTCAGCTTCAGATTAATGATCAAAGGTTTGAAGATGCGGAGGAAATGGACAGTGACACCAAAAATGGCCATAACCATTCCTAGTCAAGATTACCT
TTAAGTGTGTGAACCTGGTGGAGCTTTTCTCATTTCAGATTCAGAGTTTCTTGTGCTACTTGCTGATTTGGATGAACAGAGTTTTTGCGAAAATG
ATTAGAATTCTATACAGGAACTAGTAGTTNTATTATGTCACAAATAGTGATCCATGATTAATGCGAGCTGAGATGATATAGCTCAGTTGTAGGTA
AAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E455708] SGN-U271945 Solanum tuberosum Build 4 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T241284 [Download] [View] Facility Assigned ID: PEYEA45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0071 Quality Trim Threshold: 12.5