EST details — SGN-E455864

Search information 
Request: 455864Match: SGN-E455864
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C243277Clone name: cSTS-27-H4
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E455864Length: 713 bp (911 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E455864 [] (trimmed) AATATCTCAAATTTCCTTCTTCCATTTGTACACACTCGTCAAGATTCAATACAAATGTCTTCTTCAAAATTTGAACCAAATGATGACATATTTGA
TTTTGTAATCAAGAAAGCAAATGGAATAAAAGGCCTAGTAGACACAAACCTTGAAATTATCCCAAATCAATGCATTCAACCAAAAGAACAAAGAC
TAGACAAGTCCCAAATTGATAATCAAGAATCAATCCCAATAATTGATTTATCAAATTTTGATGATTTAAATGTTGAAAAGTCAATTCAAGAAGCA
GCAAGCAAGTGGGGTTTCTTCCAAATCATCAATCATGGGATCCCAACTGAAGTTCTTGAAGATTTGAAGGATGCGGCACACAAATTCTTTGAATT
GCCAGCTGAAGAAAAAGTTAAGTATCGTAAAGAAAAACTTAGTCCGGGTGAATCTGTGTTTATGTTTTGGAGTGCTATTGGTGAGAAAGATGAGA
AAGTTTTGGAGTGGAGGGATGGTATAAAACATGGTTGTAATCCACAAAATGATAGCAATCTTTGGCCTCCTCAAACAAGGAACCAAGTTTTGGAG
TATCAAAAGTGGGCTAAACCACTTGCTAAAAAATTGCTTGAGGTGCTATTGAAAGGTCTCAATGTCAATGAAATTGACGAATCTTTAGAACCTCT
CTTTATGGGAACTATGTCTATAAACATCAACTACTATCCACCATGCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E455864] SGN-U269498 Solanum tuberosum Build 4 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T241440 [Download] [View] Facility Assigned ID: PEYED38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5