EST details — SGN-E456815

Search information 
Request: 456815Match: SGN-E456815
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C244563Clone name: cSTS-30-J15
nocartOrdering Not Available
Library Name: cSTSOrganism: Solanum tuberosum

Tissue: sprouting eyes from tubers
Development Stage: 12-14 weeks post harvest

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E456815Length: 662 bp (890 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E456815 [] (trimmed) GTGAGAAACAGGAGATTTCAAGAAACAGTAATACTGCCGCCGTTTAACTAAATGAAGCTTCTTGAATTTTAGCAAATTTGATCAACCAAAAATGG
CATCTTTCCAGTTATTGAAGTCTCCATTCTCATTTCCTCAATCTAATTCTAGTCGTTTTTCCACTATAGTCCAAAGAAGGATTTTGGGTGTGAGA
TATCAAAGGAAAAATCCAATCTTGAAGACATTTGTTGATACAAAGTTTAGGGTTAGTTGTAGAATTCAAGACAACGAAAATCAGAGTAATGGTGA
AGAACCACCAGAGTCATTGTTTATGAAAGAGTTGAGAAGACGTGGCATGAATCCAACTTCATTGCTAGAGGAGACAAACACAAATATCAAAGAAG
ACGAGGAGACAAAATCTAGGGAAGAAGATGGAGGCTTCTATCGTAGAAATGCACTGTCAACAGATTCTGGAAGAAATTTGACTAATCAAAGGGAA
CAGTCTATGGCACTGAATAGTGAAGGCCTTGAGGGTTTGATTCCGCGGGCAAAACTTTTGCTTACTCTTGGTGGAACATTCTTTTTGGCATTTTG
GCCGTTGATCCTTGTAACTATTGCAGCTTTCTTGGCTTTATACCTGTATTTTGGACCTTCATTTGTCCATTACGCAACCAACAGATCGACAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E456815] SGN-U272292 Solanum tuberosum Build 4 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T242391 [Download] [View] Facility Assigned ID: PEYEO56TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5