EST details — SGN-E457543

Search information 
Request: 457543Match: SGN-E457543
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C253527Clone name: cPRO-3-C7
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E457543Length: 781 bp (961 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E457543 [] (trimmed) AAACATTAGCTGGATGTGCTCAGCCTCATGTTTTGAATGTGTTGAATCGTGTATCCAAAGAGATGGTGCCGTTTGATGGTGTTGTGTTTTTTTTA
AATGTGTGGACAAGTCTTTGTAGACCTTGTTTTTGTGAGTAAAGGTAACTGTTCGTGTGCTCTTTACCATCATCTATCTGCATATGTTTGTCGAA
TCTATCGCTGTATATTTAGTTGGTCATCTCTGTGACAATCAGCACAATCAGTTCCTCTTCACTCTATGGGAGGATTTTGGAGAAATAGAAGGACA
CCAAATTTCCTCAAAAATGGCAACAGAGACAGATCTACTTGTAATCCTTGGAAGAAGTATAGGAATCTCTACTTATCAAGCCTGTCACTGCAGAC
TAGGTACAACTCCACAGTACAGCTGAATCCAAATTATCCCCAAGCAGTTGCACTCCTCAACTGCCACCCCTTCTGGCCAACAACTTTTCTCTATT
GGAGAAATCTCATCAGCACCTTCCATGGGAGTCTTTTATGCTCAAGCAGAGATGGCCATATTAGATGAGTTCCAAGACTTCTGTGTGCTTGAATG
CTCAGTATGCAAACAGAAGAAGCGAACAAAGGATAGAAAGGATTTTGACTGTCCAAGATGCAATCGGAAAACATCATTAGTCCCTCGCTGTAGCT
TCCAAATTGATCTTATTGACGATACTGCTACAACCACAGCATCTATCTCTGCTGAATTANGCGAAAATTACTTTCGATGACAGCAGAAGACATAT
TTGACATAACTTGCACTAAGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E457543] SGN-U268176 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T243119 [Download] [View] Facility Assigned ID: PROAI16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5