EST details — SGN-E458011

Search information 
Request: 458011Match: SGN-E458011
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C255399Clone name: cPRO-4-K16
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E458011Length: 465 bp (964 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E458011 [] (trimmed) CTGCTGATGAAATTGGCAAAATTCACCTAATTGCAGATGAAATGGTTCAGGGGGCCATCTTTGATCTTCCTGAGGAGATTGCTGCAGATCTACTA
AATCAGGAGTTACCACCTGGAAATACTATTTCCAAGATTACCAAGTTACCTGCTTTACAAGACGATGGGCCAGCTGGTGATTTCTATGGGAGGTT
TTCAAGCAGGGATACTAGGGGGACACGAGGAGGTTTTAGAGACCGTAGAGGCAGATATTCTCAGGGTTCTTCTAGTGGCCGTTTCTCTGATAATG
ATGATGATAATTGGGGGAATGACTCTAGGTCGCGAGGTGGCCAGACAAGAAGGGGAGGAAGTGATTGGCTCATCAGTGGTGATAGGCGCTCTAGC
AGGTCTTTATCTGGAGGAAGCAGAGACAGAAGCTTTGGTGGTGCATGTTTCAATTGTGGGCGCAGTGGTCACCGAGCATCTGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E458011] SGN-U273193 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T243587 [Download] [View] Facility Assigned ID: PROAN68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0148 Quality Trim Threshold: 14.5