Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E458359

Search information 
Request: 458359Match: SGN-E458359
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C255541Clone name: cPRO-5-B1
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E458359Length: 680 bp (897 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E458359 [] (trimmed) GCAGACTCCAATATTGTGATTATGCTGATTGGAAACAAGACAGATCTGAAGCATTTGCGAGCAGTTGCTACAGAGGATGCTCAAAGCTATGCTGA
AAGAGAAGGGCTTTCTTTCATAGAAACATCAGCCTTGGAGGCAACAAATGTTGAGAAGGCTTTCCAGATGAATCTTTCGGAAATTTATCGGATAA
TCAGTAAGAAGTCACTCTCTTCAGAAAACCCTGCACCTGCTAACATTAAAGAAGGGAAGACTCTTGTTGTTGGAGCAGAGGAGATAAACACCAAG
AAAGCTTGTTGCTCTGCATCTTAATGATTCATCACTTCTTTCAATCCGCTGTTTGATTCCTTATTTTCAATCGATTGCTTTTATATTTGTTTTAT
ATTTTCTATCAATTGTCTTGATCCTTTTGTTATTATTATTGTAATTAAATTTTGAACTTGTTCTTGATTTATTCTATGTAATTTTGCTATTCTCA
AGTGATGAGAATCAGACCTGCAACACACTTGTTAGTGATTGAAGCTTTACTATTCAGTTTCAGAGATGGCATACGGTTCAGTTTACCGAAGCCAC
TTCTTCTAGTACTCCCTGTAGTCTATAATATTTGAATTTTTTTAGTCTATTTTAATGTTCAAATAAGTTATTTGTTCAATATTGAAGAAAAGTAT
TTCGAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E458359] SGN-U271031 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T243935 [Download] [View] Facility Assigned ID: PROAS01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0087 Quality Trim Threshold: 12.5