EST details — SGN-E458790

Search information 
Request: 458790Match: SGN-E458790
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C256175Clone name: cPRO-7-K20
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E458790Length: 488 bp (868 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E458790 [] (trimmed) TGAAGGTTGGCCCTGCATTAGCAGCTGGTTGCACTATGATTGTCAAACCTGCCGAACAAACTCCTCTTTCCGCTCTCTATTATGCTCAATTGGCT
AAGCAGGCAGGTGTTCCCGATGGGGTGATCAATGTCGTAACAGGATTTGGTTCTACTGCTGGTGCTGCACTTTGCTCGCATATGGACGTAGACAA
GATAAGCTTCACAGGTTCGACAGAAGTAGGACGTCTAGTAATGCAGGCTGCAGCATTAAGTAATTTAAAACCTGTCTCGCTAGAATTGGGAGGGA
AGTCGCCTTTTATAGTATTCGATGATGTAGATGTTGACAAAGTTGCACCACTTGCCCTAGTTGGAATCCTATACAACAAGGGAGAAATTTGTGTG
GCTGGATCTCGTCTTTTCATCCAAGAAGGTATTTACGATAAATTTGTCAAGAAATTGGAAGAGATGGCAAAAACATGGGTGGGTGGTGATCCTTT
TGATCCAAATTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E458790] SGN-U274645 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T244366 [Download] [View] Facility Assigned ID: PROAZ70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0084 Quality Trim Threshold: 14.5