EST details — SGN-E459111

Search information 
Request: 459111Match: SGN-E459111
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C254853Clone name: cPRO-33-I18
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E459111Length: 665 bp (863 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E459111 [] (trimmed) GTAGTGGGATCGAACCGCCAAAAGCAAAAGCCCTAGCCTCCTTTAACGAGCCAGAGCGAGGGAGCGAATCGCTCTATTCTCGCTCTGGCTGTTCA
ATTCATCAACAATTGCCAAGTTCATGGTTCCATGTCATGTCGAAAAGGATTCTTTGCAAGTTCTTTGTAAATGGTGCATGTCTGAAAGGAGAGTA
CTGTGAGTTCTCGCATGATTGGAAAGATCCTCCAAATAATGTATGCACATACTACCAAAAAGGATTATGTGCCTATGGCAGCAGGTGTAGATACA
AACATGTTAAAGTTTCTGAACAACCCTCACTTCCATCTTCGTCAGCTCCAGCTCAACATCTGCTCTCAGCTTCTCCTCCCACCACCCTCTCTCCT
GGAATGCTAGCAAATGGTGCAGGACTTCTTTCAGGCATTTCTTCCGCGTCAGGCAGATCTTTTTACCCTCCCAACCAGCCTGTATGGAGTGAAAA
TTCAGAGCATCATGATGCGGCAGTTATTGATAATATTGTCGAGTTAAAGAGAATGAATCCAGCTGATCGATCAATTTGCTCTTTTGCTGCTGCTG
GTAAATGTCCACGGGGAGAAAACTGTCCTTATATTCATGGAGATTTATGTCCAATATGTGCGAAGAATTGCTTGCATCCCTTTCGGCCTCTTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E459111] SGN-U269993 Solanum tuberosum Build 4 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T244687 [Download] [View] Facility Assigned ID: PROEZ57TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0038 Quality Trim Threshold: 14.5