EST details — SGN-E459796

Search information 
Request: 459796Match: SGN-E459796
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C253163Clone name: cPRO-29-A3
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E459796Length: 295 bp (878 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E459796 [] (trimmed) CTATAAGTGATTTGTAAAAGTAGATGAGCAAATATTTTAGAGGTCTACCTTGTACACTACCTCTGAAGATTTTTTTAATTGGTGTTTTTAATCGT
ACTGCTGGTTTGTCAAACATCTAATGGATTGCACTGTTCTAGCTTCCATTAATTGTTCGTTCAGAAAGTGCAGCATAAACAGTCTAGCTATCCAT
TTAAGCTGCTTAAGTGTCTCATCGTGAGGGGTGTGTCTGTGGACTCTTTCAGTCATTTTAATGCCGCATTCTGTGGGATGGCTTAATTCCTCATA
AAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E459796] SGN-U269134 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T245372 [Download] [View] Facility Assigned ID: PROEI02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0011 Quality Trim Threshold: 12.5