Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E460126

Search information 
Request: 460126Match: SGN-E460126
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C253865Clone name: cPRO-30-C9
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E460126Length: 608 bp (930 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E460126 [] (trimmed) GGTGGTGGATGCTTTAGTTCCATTAGCAGAGATGTTCAATTACGTTAGTACCTTGCGAGGGATGACAAAGGGTCGTGCATCTTACGTTATGCAAT
TAGCCAAATTTGACGTTGTCCCTCAACACATTCAAAACCAGCTTGCCAAAAAGGAGGAAGCAGCAGCCGCTTAGTCAGTCATCTTCCAGATTTTG
GATCCACGAACTTGAAAATAGGTATTTTTACTCGACAAAGATGTTAAGGCTTGCACAACATTCTTTTTGTACGTACTAGCATGAAACACCGATGG
AGAATAGCTGATATTTAGTTATACGTCTGAGTTTTTTCAGCCATTTGTGTATGTCGTTGAATTTATAAGCTGAGACTCCGAAGGGACAGAAGAAA
GAAAGGACTAAATGTGTATACATGCATTTAAGATATCTCTGCATCCAAAGAAGCATCAATATTTTAGGGCAAGATTGAGTGTGTCCTGATTTTGG
GATTATTTTTCTTACTATAGAAGAAACAAATATATGCTTTGTAACAATTTGATGCTCTTTATTGAGATCTTANGTGTAACATCTGACGGTTTGAG
TTGTTTATTTCACATTTGTTTTATGTTGCAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E460126] SGN-U272047 Solanum tuberosum Build 4 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T245702 [Download] [View] Facility Assigned ID: PROEM17TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0087 Quality Trim Threshold: 12.5