EST details — SGN-E460335

Search information 
Request: 460335Match: SGN-E460335
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C254092Clone name: cPRO-30-P15
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E460335Length: 611 bp (899 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E460335 [] (trimmed) TGCTAGGGAAGGACACACTGCTACTGTCCAGTACCTCATAGAACAGGGTGCAGATCCTGCAATACCCAGCGCCTCAGGGGCAACAGCTTTGCATC
ATGCTGCAGGAAATGGACATGTTGAATTGGTTAAATTGTTACTATCAAAGGGTGTAGATGTTGATTTACAAAGTGAGGCTGGAACACCGCTTATG
TGGGCTGCAGGTTTCGGCCAGGAAAAGGGTGTCAAGGTTTTGCTGGAACACCATGCTAATGTTCATGCTCAAACAAAAGATGAAAATAATGTCTG
TCCTTTGGTATCAGCTGTAGCAACTGATTCATTGCCTTGCGTGGAGCTGTTAACGAAGGCATGGGCTGATGTCAATGTTACGACTGGTGATGCAA
CTCCTTTGCTCATTGCTGCTCATAATGGTAGTGCAGGAGTCATTAACTGCTTACTACAAGCTGGAGCTGATCCTAATGCGGCTGACGAGGATGGT
ACCAAGCCAATACAAGTTGCAGCTGCAAGCGGCAGTAGGGAAGCTGTTGAAGCTTTATTGCCCGTCACAGAACGGATTCAGAGTGTTCCATAATG
GAGTGCGGATGGAGTGATTGAGTTTGTGCAATCTGAATATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E460335] SGN-U271964 Solanum tuberosum Build 4 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T245911 [Download] [View] Facility Assigned ID: PROEO92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5