Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E460983

Search information 
Request: 460983Match: SGN-E460983
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C255002Clone name: cPRO-33-P12
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E460983Length: 696 bp (855 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E460983 [] (trimmed) CTGCAACAGTGAGGGTATCAGCAAACAACACTATAACAGCTTCACTCATATCGAAAGGTCCTCTCCAAAAGACCAGCATTTTCAACCTTTGCTTC
CGTAATGGAGGTGCTTCTGCACAAAGGAGGCGACATTTCAGTTGCAGTGCTATTTACAATCCCCAGATTCAAATCAAACAACACGGACAGCCTGA
AACGTTAGATTATCGTGTATTTTTTGCGGAAGATTCCGGCAAAAAGGTATCCCCTTGGCATGATATACCACTTCATTTAGGTGACGGTGTTTTCA
ATTTCATTGCTGAAATTCCCAAAGAATCAAGTGCTAAGATGGAAGTTGCTACGGATGAGCAGTACACACCAATTAAACAAGACACAAAGAAGGGG
AAACTTAGATACTATCCATATAATATTCACTGGAACTATGGATTGCTTCCTCAAACCTGGGAAGACCCTTCATTGGCAAATGCTGAAGTTGAGGG
GGCATTTGGAGATAATGACCCCGTTGATGTTGTCGAGATTGGGGAAAGCCGTGCTAAAATTGGCCAGGTCTTGAAGGTCAAACCTTTAGCTGCTT
TGGCAATGATTGATGAAGGAGAACTTGACTGGAAAATAGTTGCTATTTCCTTAGATGATCCCCAAGCTTCACTTGTCAATGATATTGATGATGTT
GAGAAACATTTTCCGGGAACTCTGACAGCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E460983] SGN-U269703 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T246559 [Download] [View] Facility Assigned ID: PROFB90TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0011 Quality Trim Threshold: 14.5