EST details — SGN-E461048

Search information 
Request: 461048Match: SGN-E461048
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C255128Clone name: cPRO-34-K11
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E461048Length: 644 bp (838 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E461048 [] (trimmed) CAAAGCTTGAACTTGTCAACATGAAGATAGACTTCTTGAACAGAAATGTAAATGAAGGATTCAGTGGTGGAGAAAGGAAGCGCAATGAGATTCTG
CAACTAGCGGTTCTCGGGGCTGACTTGGCAATACTGGATGAGATTGATTCTGGTTTAGATGTTGACGCACTTCGAGACGTAGCAAAGGCAGTAAA
TGGACTTCTATCGCCAAAGAATTCGGTGTTGATGATTACGCATTACTTACGATTATTAGAATTCATCAAGCCGACATATATCCATATCATGGAGA
AAGGGAGAATCGTGAAGACTGGAGACATATCAATAGCAAAAGTTCTGGAGAAAGAAGGCTACAAAGCAATTTCTGGCCCATAGAGCTGCAATGAA
TGATGATGATTTTTTTCGTTGTCTCATCAGCTACTAGAGGAAATATTTCTACTGCTCCAACATTATTTAAGGAAGTGGCAATAAGTGATGCTTCC
ACTTTTCTCATCAAATGATTCAAAAATATCAGTGCTCAATTGTCTCAACATGTAAGAGTAAGGATAAACTATGTCCTCTGATGTAGGCAAAATGA
GGAATTTTTATGACATGGGGGATCGAGTCATATACTTGTATTTTATCCCGTCTTTTTTTTTTTTTTTCTAAAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E461048] SGN-U272369 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T246624 [Download] [View] Facility Assigned ID: PROFC66TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0002 Quality Trim Threshold: 14.5