EST details — SGN-E461210
Search information |
Request: 461210 | Match: SGN-E461210 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C256236 | Clone name: cPRO-7-N3 |
| ||
Library Name: cPRO | Organism: Solanum tuberosum |
Tissue: roots
Development Stage: in vitro grown stem cuttings
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E461210 | Length: 167 bp (891 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E461210 [] (trimmed)
GCTCAAAACTTTTTCCTTTATATCATCCCTTTTTCTTCACGTATCTTCTACAACTAAAAGAAAGAACCCATTTTTTGGAAAATTGGTTCTTGAAA
GGATAAAGATTGAATCTTTTTTGTGTTTTATGAAATGGGTGGTCAGTGTCAAGAAAATATTTTGGGTACTGG
GGATAAAGATTGAATCTTTTTTGTGTTTTATGAAATGGGTGGTCAGTGTCAAGAAAATATTTTGGGTACTGG
Unigenes |
Current Unigene builds | |||||
[SGN-E461210] | SGN-U271013 | Solanum tuberosum | Build 4 | 16 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T246786 [Download] [View] | Facility Assigned ID: PROBA74TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.907 | Expected Error Rate: 0.0118 | Quality Trim Threshold: 14.5 |