EST details — SGN-E461415

Search information 
Request: 461415Match: SGN-E461415
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C256472Clone name: cPRO-8-K18
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E461415Length: 376 bp (793 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E461415 [] (trimmed) ATTTGGTGCTATTCCTATAATTGTTGCTTCATCTCCTCATGCTGCTGAACAATTCTTGAAAAAACATGATCTTATTTTTGCTAGTAGACCAAATA
ATAGAGCTATGCAAATCGTCGCGTATAATCAGAGAAATTTGACATTTGGAAAATATGGACCTTATTGGAGAAATATGCGAAAATTATGCACGTTA
GAATTGCTTAGTCCACTCAAGATCAATTCATTTCAAGATATGAGAAAACAACAAGTTACAAATTTTGTGACTTTTATCAATCGGGCAGCTTCTAG
TCATGTTGAAGTTGATATTAGTGCTAATCTTGCTTTATTAAGTGCTAATATGTCATGTTTAATGATATTGGGGAAAGATACATGGATGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E461415] SGN-U272549 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T246991 [Download] [View] Facility Assigned ID: PROBD69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0086 Quality Trim Threshold: 14.5