EST details — SGN-E461524

Search information 
Request: 461524Match: SGN-E461524
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C256306Clone name: cPRO-8-B20
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E461524Length: 697 bp (877 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E461524 [] (trimmed) AAAAGGGAGTCGCCGTTGACACTGTATTCGGAAGAAGAGGGCAAACTATGGGGGAAATGGCAGAGAATGACGAGTTTTACCTGAGATATTACGTG
GGTCACAAAGGAAAATTCGGTCACGAGTTCTTAGAGTTTGAGTTTAGGCCTGATGGCAAGCTCCGTTATGCTAACAATTCCAACTACAAGAACGA
TACAATGATTCGCAAGGAAGTCTTCCTTACCCCTTCTGTTCTCAAAGAATGCCGCCGCATTGTTGCTGATAGCGAGATCATGAAGGAAGATGATA
ACAACTGGCCAGAACCAGATAGAGTTGGTAGACAAGAGCTTGAGATTGTGATGGGAAATGAACACATATCATTCACTACATCTAAGATTGGTTCA
TTAATGGATGTGCAGACCAGTAATGATCCCGAGGGACTTCGCATCTTCTATTATCTTGTTCAGGATCTGAAGTGTTTTGTGTTCTCTCTCATCTC
ACTCCATTTCAAGATCAAACCCATTTAACTAGTTCTTATGGCGTATGCTAAACATTAGCTGGATGTGCTCAGCCTCATGTTTTGAATGTGTTGAA
TCGTGTATCCAAAGAGATGGTGCCGTTTGATGGTGTTGTGTTTTTTTTAAATGTGTGGACNAGTCTTTGTAGACCTTGTTTTTGTGAGTAAAGGT
AACTGGTCGTGTGCTCTTTACATCAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E461524] SGN-U268176 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T247100 [Download] [View] Facility Assigned ID: PROBF10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0087 Quality Trim Threshold: 12.5