EST details — SGN-E461838

Search information 
Request: 461838Match: SGN-E461838
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C256596Clone name: cPRO-9-B24
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E461838Length: 741 bp (888 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E461838 [] (trimmed) CTGAAGTCAAGTCTGTAGAGATGCACCACGAAGCTCTCCAGGAGGCACTCCCTGGTGACAATGTTGGGTTCAACGTTAAGAATGTTGCTGTTAAG
GATCTAAAACGTGGTTTTGTTGCCTCAAACTCCAAGGATGACCCAGCTAAGGGGGCAGCCAGCTTCACTGCCCAGGTCATCATCATGAACCATCC
TGGCCAGATTGGAAACGGATATGCACCAGTGCTCGACTGCCACACTTCCCACATTGCTGTCAAGTTTGCTGAGATCTTGACCAAGATTGACAGGC
GTTCAGGTAAGGAACTTGAAAAGGAGCCTAAGTTCTTGAAGAATGGTGATGCAGGTATGGTTAAGATGATTCCCACCAAGCCTATGGTTGTTGAG
ACTTTTGCTGAGTACCCACCATTGGGTCGTTTTGCTGTGAGAGACATGAGGCAAACCGTTGCTGTCGGTGTTGTCAAGAACGTTGACAAGAAGGA
CCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGGGAAAGTGAACACTGCAGTTTGATGCTGGTGAGGAGGTGCATTTGATGAGCATGG
ATGAACTAGTTTTGTTTATTTGCAGAAGTTTTTTACAATTTTGTTTTGGACAACATTTTACCAGTTTTGGGTATGGCTACAGAAGCTTTTGTCAT
GGTTCTCTAGCCTCTTATGTGGATAGTGGAGTAATTTGAGCATTTGGTCCCTGTCCAGTTGCTTGATGGGCATGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E461838] SGN-U277729 Solanum tuberosum Build 4 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T247414 [Download] [View] Facility Assigned ID: PROBJ12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0101 Quality Trim Threshold: 14.5