Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E463450

Search information 
Request: 463450Match: SGN-E463450
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C248568Clone name: cPRO-14-N13
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E463450Length: 583 bp (894 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E463450 [] (trimmed) AAGTCGCCTCCTCCACCGTCACCTTCTCCACCACCTCCTTACTACTATCACTCTCCACCTCCACCCGTAAAGTCTCCTCCTCCTCCTTATTACTA
CAGCTCACCTCCTCCACCAGTGAAATCACCTCCTCCACCGGCGTACATTTACTCTTCACCACCACCACCCGTCCACTACTAAGAGTTTTTAAGAG
TGCAGTCATTCTCCACAATCAATCAAATTTTAGTTTGAAACACAAAATAAATGATGGCTTCTTGAGGAATAGATTCAAACGTCAATGGTACAAAG
CAATTAATTTATGGAATAAGATATTCAATCTTTTAATTGAAGGGTTGATTCTTCATGACATGGACCAATTTGATTCTACTTCTCTTTTGGTTTTC
TTGCACATTGTTCTCTAAGTGCGTTCACATGAACGTATCTAGGCTTTGATGCTTCTTAGAGCTTGTTTCTTTGTAACTTATTATTTGTATTGAGG
ATATTCTCCTCTTTTTATTCATTCTTATTAATTATTATTGGATGTTGTTCTTGTAACACTGTACTTTGTGCACAAATCAATAAGATGATCAATTT
TATTAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E463450] SGN-U269046 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T249026 [Download] [View] Facility Assigned ID: PROCC79TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0054 Quality Trim Threshold: 12.5