EST details — SGN-E464328

Search information 
Request: 464328Match: SGN-E464328
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C249454Clone name: cPRO-17-N11
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E464328Length: 367 bp (903 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E464328 [] (trimmed) GGTAGATACTGGACCATGTGGAAGTTGCCTATGTTTGGGTGCACTGACGCAACCCAGGTGTTGGCTGAGGTTCAAGAGGCCAAGAAGGCGTACCC
ACAGGCCTGGATCCGTATTATCGGATTCGACAACGTTCGTCAAGTGCAGTGCATCAGTTTCATTGCCTACAAGCCAGAAGGATACTAAATTTCAT
CAAACCTATAATTAATTACTCCTATGTTTGTTTGATTTGTACCTAGTCTTTTTTAAAAAAAAATTACCCCTACTGTTTTTTGCGTTTTGTACCGG
TGTATTTTCCTCGATTCCGACCAAGTTATGAGATATTAATAATGATGAATCGGTGCTTATATGTTTTTTTAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E464328] SGN-U281209 Solanum tuberosum Build 4 108 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T249904 [Download] [View] Facility Assigned ID: PROCO78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5