EST details — SGN-E465953

Search information 
Request: 465953Match: SGN-E465953
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C251150Clone name: cPRO-22-B18
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E465953Length: 535 bp (893 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E465953 [] (trimmed) GTGGAGCGCAGGCAATGAAGAGAATTCCACGAATCAAGTTTCCACAGAGGCATTCAAAGCATTCTGGTACCACATCACAGAATTCCCAACATCAG
AAAACTCCAGCAGCTGAAGAAACTCCTCGAACATTTTTCTCAAGGTCCCCACCTAGCATGTCTGTTGCAGGGAAGGCTTCTGATCAACCCAAAAG
AACACCAGTTACTCAGGAGGAAATTGAATCCATTCTGTTGGGTGGCTGCATCTAACTTCAAAGCAAATTACCTTCAGAGAGATGACACAGCTCAC
AACTGCACGCTCATGTTTAGTGACTGGTTGACTACATTTTGGTGTTTATGTTTTAGCTGTTGTACTTCTTGAAACCAGTGACATGATTGTTAATA
ATTCATTATGCACGGAATGGTTATCGAGACCTGGATTGGCAAACTACTGTGTACATTGATAGGCCTTTTTTTTTTTATGCAGAATGTAACCATTT
GCAGAANANNNANAAANAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E465953] SGN-U272880 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T251529 [Download] [View] Facility Assigned ID: PRODJ09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0169 Quality Trim Threshold: 12.5