Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

EST details — SGN-E466076

Search information 
Request: 466076Match: SGN-E466076
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C251655Clone name: cPRO-23-K1
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E466076Length: 718 bp (891 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E466076 [] (trimmed) GTTTCTTCACCCCCACAATCTCCGTCGAACTGGCGATGGTCGATAACTTCGATGATATCATCAACTGGGACGATGTAGATCACATCTTCCACAAC
GTTCTAGACAATCCCCACGATGATGATCAATTCACTCTTCATGATTCCTCCCCACAGACATTCCAGCAGATCGAGCAGCTTCTTATGAACGATGA
CGATGTCGGTCTTGTCTCTTTTGAAGACGCTGATCCTCAATTTGCTGCCGACTTTCTCTCCGACGTCCTCGTCGATTCCCCTCTTCACTCCGATC
ATTCTCACTCTCCTGCTGAACAAGCCATTGGATTCACCGATTCCAAGGTTTCTAGTGGATCCGACGCCGATCAGGACAAACACAAGTCGCCTTCT
GACGGGGACGACGAATTAAACAACCATGACCCTGTCGATAAGAAGCGCAAGAGGCAATTGAGGAACAGAGATGCAGCTGTGAGGTCACGAGAGAG
GAAGAAGTTGTACGTTAGGGATCTTGAGTTGAAGAGTAGATACTTTGAATCAGAATGCAAAAGGCTGGGGTTTGTTCTCCAGTGTTGTCTTGCTG
AAAATCAAGCTTTACGCTTCTCTTTGCAGAATAGCAGTGCTAATGGTGTTTCTATGACCAAGCAGGAGTCTGCCGTGCTCTTGNTGGAATCCCTG
CTGNTGGGTTCCCCTGCTTGGTTCCTGGGCATCACATGCCTGCTCATTCTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E466076] SGN-U270357 Solanum tuberosum Build 4 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T251652 [Download] [View] Facility Assigned ID: PRODK61TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.990 Expected Error Rate: 0.0102 Quality Trim Threshold: 14.5