Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E466808

Search information 
Request: 466808Match: SGN-E466808
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C252418Clone name: cPRO-26-M11
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E466808Length: 332 bp (950 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E466808 [] (trimmed) TGGAGAAATACCTTGAGGGGGTTGAACCTGATGAGGCAACCATTAAACAGTTGATCAGGAAGGGAACTATCTCTGGCAATTTTGTCCCTGTATTA
TGTGGCTCAGCTTTCAAGAACAAGGGGGTTCAGCCGCTTCTCGATGCAGTTGTGGATTATTTGCCTTCTCCAGTTGACGTGCCACCCATGAATGG
AACCGACCCTGACAACCCAGAAGTGATCATTGAGAGGGCCCCAAATGATGATGAACCATTTACTGGTTTGGCATTTAAGATCATGAATGATCCAT
TTGTCGGGACTCTCACATTTGTCAAGGTATATTCAGGGAAGCTTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E466808] SGN-U276283 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T252384 [Download] [View] Facility Assigned ID: PRODW78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0182 Quality Trim Threshold: 14.5