Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E467042

Search information 
Request: 467042Match: SGN-E467042
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C252370Clone name: cPRO-26-J22
nocartOrdering Not Available
Library Name: cPROOrganism: Solanum tuberosum

Tissue: roots
Development Stage: in vitro grown stem cuttings

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E467042Length: 722 bp (903 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E467042 [] (trimmed) GGCAAAGGAGAGACACTTGGAGATATCAGCAGTGGCTCCTCCAACACTAAAGAAGAGTATTTCAACTCCTTTCATGAACACAGCTTCGAAGATGT
ATTCCATGTCTGAGGTGAGGAAGCACAACTCTTCAGACTCTGCTTGGATCATAGTCCATGGACATATCTACGATGCCTCACGTTTCTTGAAAGAC
CATCCTGGTGGTGTTGACAGCATTCTCATCAATGCTGGAACTGATTGTACTGAGGAATTTGATGCAATTCATTCTGATAAGGCTAAGAAGCTATT
GGAGGACTTTAGGATTGGTGAACTCATAACTACTGGTTACACGTCTGATTCGTCTCCAAACACTTCTGTCCATGGATCCTCTTCCATTAGTAGCT
TCTTAGCACCTATTAAGGAACTTGTTCAAACACCAACAAGGAGTGTAGCCCTCATCCCAAGGGAGAAAATCCCTTGCAAACTCGTCGACAAGCAA
TCCATCTCCCATGATGTTAGAAAATTCAAATTTGCATTACCCTCTGAGGATCAAGTCTTAGGTTTACCTGTTGGCAAACACATTTTCCTCTGTGC
CACAGTTGATGACAAACTCTGCATGCGTGCCTACACACCTACTAGCACAGTCGATGAAGTAGGGTTCTTCGAGTTGGTTGTCAAAATCTACTTCA
AAGGTGTTCACCCTAAATTCCCTAATGGAGGTCAAATGTCACAACATCTTGATTCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E467042] SGN-U271417 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T252618 [Download] [View] Facility Assigned ID: PRODZ59TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0036 Quality Trim Threshold: 14.5