Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E467674

Search information 
Request: 467674Match: SGN-E467674
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C216699Clone name: cSTB-1-D1
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C216699 [cSTB-1-D1] Trace: SGN-T212896 EST: SGN-E467675 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E467674Length: 376 bp (840 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E467674 [] (trimmed) GGCTGCAGGAATTCGGCACGAGGATTTGTTTTGCGCAGCCAAAGTTCAGCGAAGCTGTCTCTCTTCCACTTTCAAAGAATCTAAGGCATTATGGG
TAAGGAAAAGATTCACATCAGTATTGTGGTCATTGGCCATGTCGACTCTGGAAAGTCCACTACCACTGGTCACTTGATCTACAAGCTTGGTGGTA
TTGACAAGCGTGTTATTGAGAGGTTTGAGAAGGAAGCTGCTGAGATGAACAAGAGGTCATTCAAGTATGCCTGGGTGCTTGACAAACTTAAGGCT
GAACGTGAGCGTGGTATCACCATTGATATTGCTTTGTGGAAGTTTGAGACCACTAAGTACTACTGCACTGTGATTGATGCCCCCGGACACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E467674] SGN-U277726 Solanum tuberosum Build 4 467 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T212895 [Download] [View] Facility Assigned ID: PSHAC13TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0043 Quality Trim Threshold: 20.5