EST details — SGN-E467694

Search information 
Request: 467694Match: SGN-E467694
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C216730Clone name: cSTB-1-F1
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C216730 [cSTB-1-F1] Trace: SGN-T212916 EST: SGN-E467695 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E467694Length: 284 bp (815 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E467694 [] (trimmed) TTCCTTCCCACATGGCCATTTTTTTCTTCCTTAAAAATATTCTTTGATTTGTATTCTTTACACCCAATGACAGAGAAGAGCTGACATCATTCTTT
TTCTCACAAATCATCATTATATAAAGTAGACTTTGGACTCTGTTTCAAGTCCGAAAACATCAGATTTTCATTCTCTAACCTCAAATCGAACCTCT
TTTTCTTGAATTTTTGGTTTTTTTTTATTGTGATTTGGATCAATGTCGAAGAATATATTGGTGACGGGTGGAGCTGGGTATATTGGGAGTCACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E467694] SGN-U274713 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T212915 [Download] [View] Facility Assigned ID: PSHAC25TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0149 Quality Trim Threshold: 14.5