EST details — SGN-E467714

Search information 
Request: 467714Match: SGN-E467714
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C216772Clone name: cSTB-1-H3
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C216772 [cSTB-1-H3] Trace: SGN-T212934 EST: SGN-E467713 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E467714Length: 350 bp (861 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E467714 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTAATAAAAGCCATAATACACTAAACAATAAGTGGAAAATCTATGGAAAAAATGAGGAAAAATAATTCAACATTAT
GATGAAAACTAAAGATTAGAAAAGGTCTTCTAAAATTAAATCAGAAGGAAGATCATATCCAAAAACCATTGAGTAATCATTAACTTCATCACTTG
TAAATTTTGGTATTCTCCAACTTTTTGCTGCCTCAGAATCATCCCCATATCTCAACAATTCTAACACCTCAGTCGTTGACGGGCGCCATACTGAA
GATTGTCTTACACAATATGAAGCTGTAAGAACCATTTTATGCAATTCGTCCATATTAAATTCACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E467714] SGN-U284479 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T212935 [Download] [View] Facility Assigned ID: PSHAC38TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.913 Expected Error Rate: 0.0035 Quality Trim Threshold: 20.5