EST details — SGN-E467795

Search information 
Request: 467795Match: SGN-E467795
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C216870Clone name: cSTB-1-P13
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C216870 [cSTB-1-P13] Trace: SGN-T213015 EST: SGN-E467794 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E467795Length: 515 bp (855 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E467795 [] (trimmed) TTTTTTTTTTATAGCAACAACGAGATTCATAAAGGTAATCAACCAACAGTAGACATTCAGAAAACATCATTTAGAATGAACAAAAAAAAATACAT
TTTTCTTGCTGAGTTTTCGATATTTAATCGACTGAAACAGGTTGCATATTCTCAGCTTCTTTCCTCAGATCTTGATACAACACAGATGATAAGTA
TCGCTCTCCAAAACTTGCATGTACAGTCACTATGAGTTTGCCTTTGTTTTCTGGTTTTTGAGCAAGTCTTAGAGCTGCTACTGTATTAGCTCCTG
ACGATATCCCAACCATGAGTCCTTCCTTCACTGCCAACTCCCTAGCCATGTTTACAGCGTCTTCGCTAGAAACCATTAGTACTTCCTCCATTAGA
TCCATATCAAGGATATCTGGCTTGAATCCGACCCCATTTCCCGTTATATGATGAGGACCTGGTTTTCCACCATTCAGTATATTGCTTTCAGTTGG
CTCGAGTCCATATATCTTGACATTAGGATTTTTGGATTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E467795] SGN-U270030 Solanum tuberosum Build 4 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T213016 [Download] [View] Facility Assigned ID: PSHAC91TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0076 Quality Trim Threshold: 14.5