EST details — SGN-E468004

Search information 
Request: 468004Match: SGN-E468004
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C218646Clone name: cSTB-2-E16
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C218646 [cSTB-2-E16] Trace: SGN-T213226 EST: SGN-E468005 Direction: 3' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E468004Length: 551 bp (1036 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E468004 [] (trimmed) CGAGGCTAATATCTCTCCATTGCCTCAATCTTTTTCTCCTGCATACCTTTTAGAGAATGGGAAGCTCTGGTGGTATTAACTATGGTTCTTACCAC
CTTATGAGAATCTTGAGAGGGAACCTTACTGGCCATCTGAGAAACTCCGTATTTCCATTACTGGGGCTGGAGGATTTATCGCTTCTCACATTGCT
CGTCGTTTGAAGAGCGAGGGCCACTACATAATTGCCTCCGATTGGAAGAAGAATGAGCACCATGACAGAGGATATGTTCTGTCATGAGTTTCATC
TTGCGGATCTTAGGGTTATGGATAATTGCTTGAAGGTAACAAAAGGTGTTGACCATGTCTTCAATCTCGCTGCTGATATGGGTGGCATGGGTTTC
ATTCAGTCCAACCACTCGGTTATCTTCTATAACAACACTATGATCAGCTTCAATATGATGGAAGCTGCTAGGATTAACAGTGTCAAAAGGTTCTT
CTATGCATCTAGTGCTTGCATATACCCCGAGTTCAAACAACTCGAAACAAATGTCAGCCTGAAAGAAGCTGATGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E468004] SGN-U268615 Solanum tuberosum Build 4 92 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T213225 [Download] [View] Facility Assigned ID: PSHAF32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0127 Quality Trim Threshold: 14.5