EST details — SGN-E468005

Search information 
Request: 468005Match: SGN-E468005
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C218646Clone name: cSTB-2-E16
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C218646 [cSTB-2-E16] Trace: SGN-T213225 EST: SGN-E468004 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E468005Length: 577 bp (989 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E468005 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTTACATATAAACCTTAACAAGATTAAAATTTTGATTACATGATCATCAACAGCAAGATCCTGAACTAGGTA
AAAAAAAACAAGAGAGGATCCACTGGCAGTTATTCAATTCTCACATTGAGATCTTCTCGAACGACTGATAAATATACTATTAAACTATCATCCCC
TTCACAAGACCAAGGGGTAATAGATTACATTGACATGTTCAAACTAAAACCAAGAAAAGCCAACAATTACCAGAACTTAACACATCTTCTACGAC
GCCATAATACATAATGCAGCAATGTCATAGCAGAGGGATTGGCTTCCAGTTGAAATGATGACAGAAGGAATGAACTTATTCCTTGCCATCAGCAG
CACGAAGGGAACCTAGCTCAACTGGAGCTTGGGTGCCCACCACCTTGGAAGATCCATAGGTTGCAGTATCAACTCCTTGAGATTTCTCTTTCTCG
ATCTGCTCCTTGATCCAGAAGTATGTAATTCTCAGACCATCCTTCAATCTCATTGTTGGAGCCCAACCAAGCTTCTCTTTTATCAGTGTGTTGTC
TGAGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E468005] SGN-U268615 Solanum tuberosum Build 4 92 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T213226 [Download] [View] Facility Assigned ID: PSHAF32TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0058 Quality Trim Threshold: 14.5