EST details — SGN-E468041

Search information 
Request: 468041Match: SGN-E468041
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C218720Clone name: cSTB-2-I18
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C218720 [cSTB-2-I18] Trace: SGN-T213261 EST: SGN-E468040 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E468041Length: 336 bp (1026 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E468041 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAAAAATAAACTTTTTTTTTATCGCATTACCATAATTGCTGATACAAAA
TATGTTATCTGCCCAAAGCAGTTGGATCCCACTTCCACAAAAATCCACAGTAGGGCGGGTCCATACATAGTAAAATCGGAATTTTACTTACAGCT
CCAGCTAGAAAAATTGGTTTGTCCAAAGGGAGATTGGCAAAACCAAGGTTAATGACCAACGCTGATAATTTACATATCCTATGTATAGATAGATA
AGGGGCCAAATATTGGCTCCAAAAAAGGGTTCAAAACTGCAAATACTGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E468041] SGN-U270567 Solanum tuberosum Build 4 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T213262 [Download] [View] Facility Assigned ID: PSHAF57TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.902 Expected Error Rate: 0.0111 Quality Trim Threshold: 20.5