EST details — SGN-E468077

Search information 
Request: 468077Match: SGN-E468077
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C218789Clone name: cSTB-2-M18
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C218789 [cSTB-2-M18] Trace: SGN-T213297 EST: SGN-E468076 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E468077Length: 620 bp (989 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E468077 [] (trimmed) TTTTTTTTTTAAACATGAAGGATAAATATTCTCAAATATCTAATAAACACGAACCAAGTCAAGTCTAGTGCTGCCAAGAGGCATCGGACATAGCA
ATTATGAAGCACAGTACAAAATTGACGACCACATTCAGTTGTTGCAGCTCGATAATGAACTAAAACAAGATTAACCAAGTGTTCTTTCAACAACT
ACATAAATCAAGAAAAGAGGGCCTGACAGACTGGAATTCAGAAGAATTACTGCTCCTTGGTGTAGTGTCGTACTGTTAAGGCCAAGCCCAAGATC
AAGATGGGTACAAGGAACTGTAGGATTTTGATAATGAATTCTGGAGTCTTGTCTGGATTGTATGCAGTTTGTTCCGATGGAATATAAGCACGTTT
TAGGGGAACTGTTGACATGTCAATTTCCCCAATGTAATACTTATCCATCATCTCTCTAGCAGAATCACTGTGGCCAACATCTTCAAAGTCATTTG
TTGCATCTTTCCCAGTTGCTGAAAGCAAAACTTCATCACCACCTGGATGATCATCCATGAACGGAGTTACATCATACACCTTTCCGCTGATGATG
AGCCAGCAATCTTTAGTCTTGTTGTGCTTAGCGACCTCCTCAAATGCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E468077] SGN-U270106 Solanum tuberosum Build 4 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T213298 [Download] [View] Facility Assigned ID: PSHAF81TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0050 Quality Trim Threshold: 12.5