EST details — SGN-E468747

Search information 
Request: 468747Match: SGN-E468747
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C226789Clone name: cSTB-6-A9
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E468747Length: 177 bp (882 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E468747 [] (trimmed) TTTGAAGAGCAGCTGTGTTGGAACCTAAAGAGAAATCCAGATCATTTAAACCTACTTTTAATGCTTCGAATGGGAAGGATGTGGTTGGGAGTTCA
TCTAGGACATCTTCAGTGCTGAGTGTAAGAAACGCCACCGCCAGGAATCTCACATAAAATCTTTCTCTCAAGTTGGAAATGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E468747] SGN-U278370 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T213968 [Download] [View] Facility Assigned ID: PSHAU05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0243 Quality Trim Threshold: 20.5