EST details — SGN-E469030

Search information 
Request: 469030Match: SGN-E469030
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C217156Clone name: cSTB-10-O9
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E469030Length: 237 bp (971 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E469030 [] (trimmed) TTATGTCTTAAATGACACCCATGACACTAAGCCATTGTGCTGGTGTAAATTGCTTGGCTTTGTTGAAGTCGTCCTCACCCGGTGGGTCTGAGTAC
CTATTTANCGGGAGCAGAGATGGGACTTTAAAGAGATGGGCCATTGGCTGAAGATGGTGCCACCTGCTGTGCTACCATTTGAATCCCATGTTGAT
TGGGTAAATGAACCCTGTTCTTACAGGCAATAACACATTGGTTTCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E469030] SGN-U273011 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T214251 [Download] [View] Facility Assigned ID: PSHBK89TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0293 Quality Trim Threshold: 20.5