EST details — SGN-E469030
Search information |
Request: 469030 | Match: SGN-E469030 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C217156 | Clone name: cSTB-10-O9 |
| ||
Library Name: cSTB | Organism: Solanum tuberosum |
Tissue: leaves and petioles
Development Stage: 8 weeks old plants
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E469030 | Length: 237 bp (971 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E469030 [] (trimmed)
TTATGTCTTAAATGACACCCATGACACTAAGCCATTGTGCTGGTGTAAATTGCTTGGCTTTGTTGAAGTCGTCCTCACCCGGTGGGTCTGAGTAC
CTATTTANCGGGAGCAGAGATGGGACTTTAAAGAGATGGGCCATTGGCTGAAGATGGTGCCACCTGCTGTGCTACCATTTGAATCCCATGTTGAT
TGGGTAAATGAACCCTGTTCTTACAGGCAATAACACATTGGTTTCAT
CTATTTANCGGGAGCAGAGATGGGACTTTAAAGAGATGGGCCATTGGCTGAAGATGGTGCCACCTGCTGTGCTACCATTTGAATCCCATGTTGAT
TGGGTAAATGAACCCTGTTCTTACAGGCAATAACACATTGGTTTCAT
Unigenes |
Current Unigene builds | |||||
[SGN-E469030] | SGN-U273011 | Solanum tuberosum | Build 4 | 3 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T214251 [Download] [View] | Facility Assigned ID: PSHBK89TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.971 | Expected Error Rate: 0.0293 | Quality Trim Threshold: 20.5 |