EST details — SGN-E469033

Search information 
Request: 469033Match: SGN-E469033
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C217142Clone name: cSTB-10-O15
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E469033Length: 604 bp (972 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E469033 [] (trimmed) CTTTTTCAAATGCTCTGTTCCTCCGTATCCATCTAAAACCTCAAACCCCATAAACCCTAAACTTCAATTTCTAAAATCTATCCAGAAAGTTCCAT
TTTTTCATTCATGGGGTCAATCAATTTCAACCCATTCAACAATAACTGGTTCAACAAACCTTCAACACCATTTCAACCAATTAATCTTCTATCCC
ACTTTGATTCCCTAAAACCCCATCAACATTCTCCGCTTTTTGCAGCTATTTCAAATCCATTTTCAAGAAAACCCAAAACACCTCCTGAAAAACCA
GGTCATTACCGGAAAATGCTGGACCAGTTCTATTGGGAATGTGAGACCCGACCCGACTTTCGACATGCTCCGAAAGTTGAGCAGATTATGAATGA
GGATCCGATTTTTGAGAAAAAGGAGAACCCAACTAAGGAAGAGATTGAGGAGAATGAGAAGTGGTTCGCTGAGTTACGGGAAAGCCCAGTGGTTC
AGTTCTTGCTCCAAGCTGAAGAGATTGCTGATAAAATCAATGACCTTGAGCTTCAAGAGAATTCAGCTCCATTTCGAAAGGAAGATAAGAAACTG
TGGCAGGCAGTGCCAAATGTCATTGGATTGGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E469033] SGN-U273003 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T214254 [Download] [View] Facility Assigned ID: PSHBK92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0078 Quality Trim Threshold: 14.5