Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E469049

Search information 
Request: 469049Match: SGN-E469049
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C216923Clone name: cSTB-10-C14
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E469049Length: 335 bp (904 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E469049 [] (trimmed) CAACAGCTATCCTAAACCCTCGAATCCCAAACTTCACTCCATTTCCTCTATACAAACTTCAATTCCTCAACTTACCTCCTTCATTTCCCAAAAAC
ACTTTTCGCTCCCAAATTCCTCCTCATTCTCTCAATTTCTCCCTTCAAAACAACTCACAGCAACCCCACTTCCCCCTCGAAGACGAAGAACACGT
AATCGGAGACTGCATAGTGTTTGAAGAAGGAATTTTCGACGACCCTTTTGTTCAAAAATCTGACAACAACCAAAATAAGCCACAAAACAATAATA
AGAAGAAATCAGCAGAAATTCAATCCGAGAATTTAATTCCTGAAGAATGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E469049] SGN-U273247 Solanum tuberosum Build 4 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T214270 [Download] [View] Facility Assigned ID: PSHBL19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5