EST details — SGN-E469385

Search information 
Request: 469385Match: SGN-E469385
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C217198Clone name: cSTB-11-B19
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E469385Length: 554 bp (990 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E469385 [] (trimmed) CTTTCTAATATCTCTCCTTTGCCTCAATCTTTTTCTCCTGCATACTTGGAGAGAATGGGAAGCTCTGGTGGTATTAACTATGGTTCTTACACTTA
TGAGAATCTTGAGAGGGAACCTTACTGGCCATCTGAGAAACTCCGTATTTCCATTACTGGGGCTGGAGGATTTATCGCTTCTCACATTGCTCGTC
GTTTGAAGAGCGAGGGCCACTACATAATTGCCTCCGATTGGAAGAAGAATGAGCACATGACAGAGGATATGTTCTGTCATGAGTTTCATCTTGCG
GATCTTAGGGTTATGGATAATTGCTTGAAGGTAACAAAAGGTGTTGACCATGTCTTCAATCTCGCTGCTGATATGGGTGGCATGGGTTTCATTCA
GTCCAACCACTCGGTTATCTTCTATAACAACACTATGATCAGCTTCAATATGATGGAAGCTGCTAGGATTAACAGTGTCAAAAGGTTCTTCTATG
CATCTAGTGCTTGCATATACCCCGAGTTCAAACAACTCGAAACAAATGTCAGCCTGAAAGAAGCTGATGCTTGGCCTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E469385] SGN-U268615 Solanum tuberosum Build 4 92 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T214606 [Download] [View] Facility Assigned ID: PSHBQ10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0068 Quality Trim Threshold: 14.5