EST details — SGN-E469570

Search information 
Request: 469570Match: SGN-E469570
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C217467Clone name: cSTB-12-F11
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E469570Length: 355 bp (892 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E469570 [] (trimmed) GAAAAACAATGCTCCCTTATCTGTTATTGCTGCTTTTAGCACACGCTGGTTGGGTAACCACAGCAGATCTAGAAAATTATTCACTAGTTAAAAAC
ATATTCATTTTAGCAGGTCAGAGCAACATTTCCGGCCGAGGCGGAGTGATTAATCACTCACTCCGTCCCGGTTTTGTTAATGAGTCGTGGGATGG
TGTCATCCCACGTGAATGCGAGTCCAACCCATCAATCCTCCGACTAAGTGGAGGACTTAAATGGGTTGAGGCTCATGAACCCCTTCACAAGGACA
TAGATGTGAACAACACTTGTGGGATTGGTCCANGAATGCCATTTGCCAATACAGCTTTGAAGAAAGATCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E469570] SGN-U275019 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T214791 [Download] [View] Facility Assigned ID: PSHBU30TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.992 Expected Error Rate: 0.0205 Quality Trim Threshold: 14.5