EST details — SGN-E470492

Search information 
Request: 470492Match: SGN-E470492
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C218486Clone name: cSTB-18-O2
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E470492Length: 493 bp (792 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E470492 [] (trimmed) GAGGATGGTATCTCTTCTCTATCGCATTCCTTAAATACAAAGCCCTCACTTTTTCACTGCCAATCTATCGATCTTTCACTCGATCCGCTCTATAT
CTCAACAATCTCCGCTCTGCAACAATGGGGGCTTCACTTTCTCCAAAAGAGGCCAACCTCTTCAAACTCATAGTTAAATCTTACGAGACTAAGCA
GTATAAGAAAGGACTAAAAGCTGCTGATACGATTCTCAAGAGGGAAACTAATCATGGAGAAACATTGTCAATGAAAGGATTAACATTGAATTGTA
TGGACCGGAAGTCAGAAGCATATGAACTTGTCCGGCTTGGATTGAAGAATGACCTTAAGAGCCATGTTTGTTGGCATGTTTATGGTCTCCTATAC
CGGTCTGATAGAGAGTACCGAGAAGCAATTAAATGCTATCGAAATGCCCTCAGGATTGATCCTGACAATATTGAGATATTACGAGACCTATCCCT
TCTACAGGCACAAATGCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E470492] SGN-U280789 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T215713 [Download] [View] Facility Assigned ID: PSHCR85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0105 Quality Trim Threshold: 20.5