EST details — SGN-E470727

Search information 
Request: 470727Match: SGN-E470727
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C218915Clone name: cSTB-20-E6
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E470727Length: 397 bp (853 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E470727 [] (trimmed) CTCTCTTTTGCTCTGGGTGTCTCTTTGCTTTCTCTCCTCTTTCCCTTGATTTCTTCATCAAACTCCACCACTACTACCATTCCACTCTCACTTGT
CAACACAAAAAAACCATCTCAAGATTTCTATGAAAAGCTCACACATTTAGCTTCCATTTGCTTGGCCAGAGCAAATTACATAAAAAAATCTGAAG
ATTCCCCTGTTTCCACAACCCCTTTGTACCCTCAAAGCTATGGAGGCTACTCAATTACTCTCAGCTTTGGTACACCTACACAGAAAATCCCTTTC
ATTATGGACACTGGAAGTAACTCTGTTTGGTTCCCATGTTCTACAAGGTACTTATGTACCAATTGCTCTGTTTGTTCAGCTACTTCACAGTCCAT
GCCTACATTCATTCCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E470727] SGN-U275013 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T215948 [Download] [View] Facility Assigned ID: PSHCZ27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0273 Quality Trim Threshold: 14.5