Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E471201

Search information 
Request: 471201Match: SGN-E471201
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C219542Clone name: cSTB-23-K19
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E471201Length: 383 bp (924 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E471201 [] (trimmed) CCACCTGGCACACCCCCTGCAAGCAGGCCGCACCACAAATCTGGAGGCAATAATAGCCCTACTGATGGTGCAAGCAGTGGTGATGGTGGTGGTAA
ATCGGGGATAGGGGGTGGAGCCATTGCAGGCATAGTGATATCTGTTCTAGTTGTTGGGGCAATTGTAGCGTTCTTTGTTATCAAGAAGAGATTGA
AGCGGTCATCGACGGACATTGAGAGACATGATAATCAGCCATTTGCTCCTCTTGCTCCCCCCCAGGAAGTATATGAATTGAAAACTAATGAAGCT
TCCTCTGCGCCAATAGTGAAAGTATTTGAAGCTCCTGCAGTAGTAAATCTAAGACCTCCACCTATTGAACGCCACAAGTCATTTGACGAAGTTGA
CAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E471201] SGN-U268912 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T216422 [Download] [View] Facility Assigned ID: PSHDK70TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5