EST details — SGN-E471568
Search information |
Request: 471568 | Match: SGN-E471568 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C219893 | Clone name: cSTB-24-O24 |
| ||
Library Name: cSTB | Organism: Solanum tuberosum |
Tissue: leaves and petioles
Development Stage: 8 weeks old plants
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E471568 | Length: 171 bp (854 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E471568 [] (trimmed)
TCGGAGCCTGTAGCCGAGAAGAAAGTTGAAACAGAGGAATTGGAGAAAACAGAGGAGAAAGTAACTCCACCGGAAACTGAAGCAACTCCGGCACC
GGCAACAGAGACACCATCGGAGACAGAGAAGGTGGAGGCAGTCGAAGAAATCAAGAAACAATTGTTGAAGTACCGG
GGCAACAGAGACACCATCGGAGACAGAGAAGGTGGAGGCAGTCGAAGAAATCAAGAAACAATTGTTGAAGTACCGG
Unigenes |
Current Unigene builds | |||||
[SGN-E471568] | SGN-U269897 | Solanum tuberosum | Build 4 | 2 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T216789 [Download] [View] | Facility Assigned ID: PSHDP96TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.904 | Expected Error Rate: 0.0068 | Quality Trim Threshold: 20.5 |