EST details — SGN-E471968

Search information 
Request: 471968Match: SGN-E471968
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C220177Clone name: cSTB-27-A19
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E471968Length: 367 bp (880 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E471968 [] (trimmed) GTTTTCTCTTCTCACACAACAAATTCATTTTCTACTCACAATTTCTTCACTTTCTCTCTCTAGAACTAGAAAAAAATGGCGATCAAGGTCCATGG
CCCTATGATGTCCCCTGCTGTTATGCGAGTCGTAGCTACACTCAAAGAGAAAGATCTTGATTTTGAACTTGTTCCTGTCAATATGCAAACTGGTG
ATCACAAAAAGGAACCATTCATTTCCCTAAATCCATTTGGTCAAGTTCCAGCTTTTGAAGATGGAGATCTCAAGCTTTTTGAGTCAAGAGCCATT
ACACAATACATAGCTCACACATATGCAGACAAAGGGACCCAACTCTTACCCAATGACCCAAAAAAAATGGCAATCATGTCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E471968] SGN-U268920 Solanum tuberosum Build 4 58 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T217189 [Download] [View] Facility Assigned ID: PSHEA10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.948 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5