EST details — SGN-E472017

Search information 
Request: 472017Match: SGN-E472017
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C220369Clone name: cSTB-27-M11
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E472017Length: 459 bp (1050 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E472017 [] (trimmed) GTGAGAGCGAAAAATGGCTTGTCTAACACAGCAATTCGTTGGGTTGAAGTGCCCACCAATTTCGACAACAAGGCTTGTGAATCCGAGTAATTATC
ATCATCAGAGTAAGCAGAAGCCAAAAATTGTAGTACAAGCTGCAGCAGTGGTTGCAAATGCACAAACAAGAGAAAGACTAAAACTTAAAGAGATG
TTTGAGGATGCCTATGAGAGATGCCGCACTACACCTATGGAAGGTGTTGCCTTTACTGTTGATGATTTTCATTCTGCCCTTGAAAAATATGATTT
TGACTCCGAAGTTGGTACTAAGGTCAAAGGAACGGTTTTTTCTGTAGATGCAAACGGAGCTCTAGTTGACATTACTGCAAAATCATCTGCATACT
TGCCTTTACGAGAAGCTTCACTTCACACCATCAGACATGTAGAGGAAGCCGGAATATTTCCTGGTTTGCGTGAGGAGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E472017] SGN-U270777 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T217238 [Download] [View] Facility Assigned ID: PSHEA78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0061 Quality Trim Threshold: 14.5