EST details — SGN-E472045
Search information |
Request: 472045 | Match: SGN-E472045 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C220204 | Clone name: cSTB-27-C12 |
| ||
Library Name: cSTB | Organism: Solanum tuberosum |
Tissue: leaves and petioles
Development Stage: 8 weeks old plants
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E472045 | Length: 186 bp (841 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E472045 [] (trimmed)
CCCAATTATCTACTAGCATCAGCCATAAGTGTCATTAAAAGATTTAGGAAGACAATAACTAGTGACCCCTCTGGCATTACAAAAACATGGGAAGG
CAATGACATTTGCAAAGACCCAACCAAGTATATAGGTTTCATTTGCAACAATAACAAAGTTGTTGCTGTCAATTTCAATGGTAGAAACTTT
CAATGACATTTGCAAAGACCCAACCAAGTATATAGGTTTCATTTGCAACAATAACAAAGTTGTTGCTGTCAATTTCAATGGTAGAAACTTT
Unigenes |
Current Unigene builds | |||||
[SGN-E472045] | SGN-U282131 | Solanum tuberosum | Build 4 | 3 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T217266 [Download] [View] | Facility Assigned ID: PSHEB18TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.935 | Expected Error Rate: 0.0184 | Quality Trim Threshold: 14.5 |