EST details — SGN-E472056

Search information 
Request: 472056Match: SGN-E472056
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C220244Clone name: cSTB-27-E22
nocartOrdering Not Available
Library Name: cSTBOrganism: Solanum tuberosum

Tissue: leaves and petioles
Development Stage: 8 weeks old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E472056Length: 288 bp (863 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E472056 [] (trimmed) CAACACACTGTTTCTTTCTTCTTCGTCTTCTTCTTCACCTGGGGAAATATGGCGGCTGTTACTTCACCATCTTTCTCGGCGATTACTCAATCGGC
GGAAAGGAAATCCTCCGTTTCTTCGTCTCGTTCTATTGATACATTTAGGTTCCGTTCCAACTTCTCCTTTGATTCCGTCAATGTTCGATCTTCCA
ATTCCACATCTCGCTTTGTCGTTCATTGCGCGCACAGTTCATCAGCAGATTTGCCAACTGTTGCTGACACTAAATTGAAGTTTTTGACCGCTTAC
AAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E472056] SGN-U272412 Solanum tuberosum Build 4 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T217277 [Download] [View] Facility Assigned ID: PSHEB35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0150 Quality Trim Threshold: 14.5